rs17358295 chr11:34632224 T>G
- Sequence
tctgtttattttcctacaaatcaa[T/G]gcttaactgcgttgttatcggagc
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor
- ASB for transcription factors
- ANDR_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.99 | 0.12 | 1.60 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.08 | 0.31 | 1.97 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, ldl cholesterol change with statins, total cholesterol change with statins, years of education