rs17358587 chr13:103188918 C>G
- Sequence
gcaagaaagtactatatatgaaat[C/G]cagaaatcactttctttttctgta
- ASB in cell types
- Jurkat (T-cells) HCT-116 (colon carcinoma) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | -1.17 | 1.84 | 1.00 | |||
| HCT-116 (colon carcinoma) | -0.99 | 1.85 | 1.00 | |||
| prostate gland | 1.97 | -1.63 | 1.00 |
Items per page:
1 – 3 of 3