rs17366322 chr2:11132658 G>T
- Sequence
tagtgcattgcactcattttcctc[G/T]cccaacataagctcatgacttccg
- ASB in cell types
- HEK293 (embryonic kidney) neutrophils from periferal blood neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.52 | 0.81 | 1.13 | |||
| neutrophils from periferal blood | -0.15 | 2.54 | 1.50 | |||
| neural progenitors | -1.99 | 2.39 | 1.00 |
Items per page:
1 – 3 of 3