rs17370078 chr20:19760014 C>T
- Sequence
caactctggcttcagatgtagtca[C/T]gttcactgaatgcagagcttttat
- ASB in cell types
- adipose MDM(monocyte derived macrophages)
- ASB for transcription factors
- PPARG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 2.60 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting insulin, homa-b, homa-ir, infant head circumference, rheumatoid arthritis