rs17372954 chr6:108765716 A>G
- Sequence
tctagtgccagctccacagtacat[A/G]ggtccattgtgtgactttgagcaa
- ASB in cell types
- 22RV1 (prostate carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.98 | n/a | 2.00 | |||
| VCaP (prostate carcinoma) | 1.06 | 0.35 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, late onset alzheimers disease, ldl cholesterol, obesity with early age of onset (age >2), tetrology of fallot, triglycerides