rs17383023 chr11:12080351 T>C
- Sequence
attcttccctttagggctttctca[T/C]tcagtaaatattcctttgctgtga
- ASB in cell types
- A549 (lung carcinoma) HEK293 (embryonic kidney) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- SP7_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP7_HUMAN | n/a | 3.27 | 1.00 | n/a | No Hit | |||
| ANDR_HUMAN | 2.71 | -0.73 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol change with statins, late onset alzheimers disease, total cholesterol, total cholesterol change with statins, triglycerides
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg