rs17385878 chr1:160607366 C>T
- Sequence
tataagtagttctataaatctcaa[C/T]ccagatctcattttggtttcaggt
- ASB in cell types
- epidermal keratinocytes HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epidermal keratinocytes | 2.48 | n/a | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -1.24 | 1.61 | 1.00 |
Items per page:
1 – 2 of 2