rs17394102 chr2:30287281 T>C
- Sequence
ctgtgggggtctgaaatatcagga[T/C]tggaatcaatggtgcttgatgtgg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN ETS1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.03 | 1.16 | 1.00 | n/a | No Hit | |||
| ETS1_HUMAN | -0.57 | 1.91 | 1.00 | n/a | No Hit | |||
| SMCA4_HUMAN | 0.19 | 1.33 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, height, hip bone mineral density (bmd), irritible bowel syndrome, mitral annular calcium, refractive error, rheumatoid arthritis, tetrology of fallot
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Minor_Salivary_Gland, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood