rs17396153 chr8:101466974 A>T
- Sequence
ccagatgaagcaccgtcaaggggg[A/T]ttgccagaaaaacgtactctgtcc
- ASB in cell types
- breast tumor
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.87 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins