rs173966 chr5:115574726 A>G
- Sequence
cgcctaggctggagtgcagtggcc[A/G]gatctaggctcactgcgacccctg
- ASB in cell types
- neural cell HCT-116 (colon carcinoma) HMEC (human mammary epithelial cells) HCAEC (human coronary artery endothelial cells)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN STAG1_HUMAN STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.98 | 0.65 | 1.36 | n/a | No Hit | |||
| RAD21_HUMAN | 1.37 | 0.07 | 1.70 | n/a | n/a | |||
| STAG1_HUMAN | 1.40 | -1.06 | 1.11 | n/a | n/a | |||
| STAG2_HUMAN | 2.09 | -0.94 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood