rs173969 chr5:40841854 C>T
- Sequence
tctgaaatttaacatcttattggt[C/T]tactgaatcgataatttgtttttc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.80 | 0.66 | 1.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, college completion, lp-pla2 activity, major depressive disorder, severe diabetic retinopathy, stabilized warfarin dose, years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Thyroid