rs17398646 chr8:66033844 A>G
- Sequence
agatgccttgagagcaattgaatc[A/G]tagttgagaaggcagcacacccta
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.65 | 0.44 | 1.12 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, cystatin c in serum, hdl cholesterol, hdl cholesterol change with statins, urinary albumin-to-creatinine ratio