rs17400379 chr7:94580620 T>G
- Sequence
agcaccatcacaagttcagttaga[T/G]ttgtttttccaaaatcacctttgt
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 0.33 | 1.61 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP late onset alzheimers disease, ldl cholesterol change with statins, major depressive disorder, major depressive disorder (females), major depressive disorder (males), recurrent early onset major depressive disorder, total cholesterol, total cholesterol change with statins