rs17401568 chr8:54558901 A>G
- Sequence
ccagacaaatattaaaactggtga[A/G]cttcaaaataacgtgaaaagctcc
- ASB in cell types
- breast tumor primary breast cancer
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.54 | -0.14 | 2.00 | |||
| primary breast cancer | 2.79 | n/a | 2.00 |
Items per page:
1 – 2 of 2