rs17407555 chr4:10273370 A>G
- Sequence
tcttgccaatagacagtccagatc[A/G]ccctaatcggtggggttcattgtt
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.78 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), hdl cholesterol change with statins, irritible bowel syndrome, schizophrenia age at onset, serum urate, uric acid
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Esophagus_Mucosa, Liver, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid