rs17410856 chr10:33155928 G>A
- Sequence
tggagacaatgtttaaggagagat[G/A]ttcaacccaagacaatgcctccag
- ASB in cell types
- 22RV1 (prostate carcinoma) heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 3.01 | n/a | 2.00 | |||
| heart left ventricle | -2.52 | 2.62 | 1.00 |
Items per page:
1 – 2 of 2