rs17411738 chr8:28203055 T>G
- Sequence
acccgaggccaggagactgcagct[T/G]agcccacctttcccgtggtttatt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.67 | -1.33 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), fasting blood glucose, hdl cholesterol, obesity with early age of onset (age >2), refractive error