rs17411858 chr1:161647726 A>G
- Sequence
tccttcgtcctgcagaagagatgt[A/G]tattgtccacttttgtttcaacag
- ASB in cell types
- glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 2.63 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, diastolic blood pressure (dbp), infant head circumference, partial epilepsy, serum creatinine, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood