rs17412982 chr4:95086645 T>G
- Sequence
ttgatgttagtagaggccatgcct[T/G]tgaacaatactgctaaggaataga
- ASB in cell types
- pancreatic ductal adenocarcinoma
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.41 | 0.23 | 1.85 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), major depressive disorder (broad definition), major depressive disorder (broad definition) (males), major depressive disorder (narrow definition) (males), parkinsons disease, total cholesterol, triglycerides