rs174139 chrX:74292860 A>G
- Sequence
ccattaccagccttccctaatgcg[A/G]gtagatgcgataaactagggaagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MCF10A (breast epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.92 | 2.97 | 2.25 | n/a | No Hit | |||
| TEAD4_HUMAN | n/a | 2.67 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood