rs17414449 chr1:55284917 C>G
- Sequence
tgaacacctggacaatattctgat[C/G]ctttaccaactgctagcccttctc
- ASB in cell types
- H929 (plasma cell myeloma) glioblastoma cells CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 1.87 | -1.66 | 1.00 | |||
| glioblastoma cells | 1.11 | n/a | 1.50 | |||
| CD34+ stem cells-derived erythroblasts | 2.56 | -4.79 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol