rs17416046 chr8:4542065 C>T
- Sequence
cctgaagtccccgtgtgcaatggg[C/T]gccctctagcttcttaccaagtga
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) stomach thyroid gland THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.18 | -1.59 | 1.08 | -0.89 | Weak Concordant | |||
| RAD21_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, diastolic blood pressure (dbp), ldl cholesterol, systolic blood pressure (sbp), tetrology of fallot, total cholesterol