rs17421154 chr2:38509858 G>A
- Sequence
cccttctcctgtcttgacaatcta[G/A]tcctagacctcaggtagtcccaca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.71 | 0.00 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP crohns disease, irritible bowel syndrome, parkinsons disease, partial epilepsy, prop taste detection threshold, rheumatoid arthritis, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial