rs17422261 chr6:44867602 T>C
- Sequence
agtaataagcaattccatccccaa[T/C]gcggacttagaatcacagcctaca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.86 | 0.30 | 1.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Thyroid, Whole_Blood