rs17423390 chr1:21687978 G>T
- Sequence
tgtgcatggatggggtagatatgg[G/T]tctgcctcatcattccagggccta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFE2_HUMAN ENL_HUMAN REQU_HUMAN ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | -4.39 | 2.88 | 1.50 | 0.77 | Weak Concordant | |||
| ENL_HUMAN | -1.19 | 2.70 | 1.00 | n/a | n/a | |||
| REQU_HUMAN | -1.22 | 1.14 | 1.00 | n/a | n/a | |||
| ZN316_HUMAN | -0.53 | 1.75 | 1.00 | n/a | No Hit | |||
| ZN639_HUMAN | -1.38 | 2.74 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 14
Motif analysis
Genetic associations
EMBL-EBI high light scatter reticulocyte count, high light scatter reticulocyte percentage of red cells, immature fraction of reticulocytes
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid, Whole_Blood