rs17425970 chr8:100417468 C>T
- Sequence
gcttcttcaatgccaaggcaagac[C/T]gggctggactgacaggtccttcaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 WS8 cells breast tumor
- ASB for transcription factors
- ESR1_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.14 | 0.44 | 2.01 | n/a | No Hit | |||
| FOXA1_HUMAN | 1.08 | 0.31 | 2.02 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP maternal imprinting effects on cleft lip and cleft palate, neuroblastoma (brain cancer), obesity with early age of onset (age >2), tetrology of fallot