rs17428956 chr1:56409371 G>T
- Sequence
ccgtcagttactgcacatgtttga[G/T]actctcactctacctgctcccacc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- IKZF2_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.28 | -0.96 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.78 | 0.56 | 1.34 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol