rs17432462 chr7:18508990 T>C
- Sequence
tagcaactggctagattcgtgaca[T/C]gttgttacaaaaaaatagttgtat
- ASB in cell types
- FaDu(Hypopharyngeal squamous cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FaDu(Hypopharyngeal squamous cell carcinoma) | -1.55 | 2.61 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), hdl cholesterol, neuroblastoma (brain cancer), primary rhegmatogenous retinal detachment, systolic blood pressure (sbp)