rs17433008 chr3:146589945 T>C
- Sequence
cttcaaaatgacaattccatgtta[T/C]tcattccatcatataagcataggt
- ASB in cell types
- foreskin keratinocyte bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.91 | -2.55 | 1.83 | |||
| bipolar neuron | 1.10 | -1.10 | 1.00 |
Items per page:
1 – 2 of 2