rs17434960 chr10:9066595 C>T
- Sequence
aagacaccaaattttcccgttgta[C/T]ttcatagataaggaacccagggca
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.55 | 1.01 | 1.26 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, celiac disease, college completion, hdl cholesterol change with statins, late onset alzheimers disease, ldl cholesterol change with statins, sporadic creutzfeldt-jakob disease, stabilized warfarin dose