rs17436109 chr8:18084530 C>T
- Sequence
cactaatgtaacatcccaccctga[C/T]ccatctttgccctctgagaaaagc
- ASB in cell types
- K562 (myelogenous leukemia) monocytes from periferal blood
- ASB for transcription factors
- SRBP2_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.19 | n/a | 2.50 | n/a | No Hit | |||
| NFIC_HUMAN | n/a | 1.48 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood