rs17436343 chr11:34998242 C>T
- Sequence
aaatgggatgctattagtgggaaa[C/T]ttttactgatttttgaagaaggaa
- ASB in cell types
- A549 (lung carcinoma) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.89 | 0.02 | 2.00 | |||
| H929 (plasma cell myeloma) | -2.70 | 1.66 | 1.50 |
Items per page:
1 – 2 of 2