rs17438195 chr3:104628432 G>A
- Sequence
tgggaatttgttttctgagtcact[G/A]cttcatatactaaaaagatgagag
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12891 (male B- cells lymphoblastoid cell line) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.20 | 1.50 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.71 | -0.60 | 1.00 | |||
| gastroesophageal sphincter | 1.99 | -1.64 | 1.00 |
Items per page:
1 – 3 of 3