rs17442995 chr14:34325521 T>G
- Sequence
gcaagtcctggaacaccaagagac[T/G]aacagtgctggaacaagggctggg
- ASB in cell types
- 22RV1 (prostate carcinoma) embryonic kidney
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.51 | -4.74 | 2.00 | |||
| embryonic kidney | n/a | 2.55 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, major depressive disorder, maternal transmission distortion