rs17444609 chr5:24110244 C>T
- Sequence
aacagtaactgcatcctttctgtc[C/T]ggtggaatattactgattgcttat
- ASB in cell types
- HMEC (human mammary epithelial cells) pancreas glioblastoma patient-derived cell model adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.05 | 0.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement, years of education
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid