rs17453205 chr11:117930920 G>A
- Sequence
agttctctcatcttggcttattgt[G/A]ggagccacttccctggctttcaaa
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) SEM (childhood B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLT-4 (Adult T acute lymphoblastic leukemia) | 0.94 | -0.58 | 1.00 | |||
| SEM (childhood B acute lymphoblastic leukemia) | 1.85 | -1.84 | 1.33 |
Items per page:
1 – 2 of 2