rs17461286 chr5:111233524 G>A
- Sequence
gcgtgaaagttaaatttccatacc[G/A]tgaacaatgttcatatcaaaagac
- ASB in cell types
- activated primary CD4+ T cells from blood
- ASB for transcription factors
- NFAC2_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFAC2_HUMAN | 2.09 | n/a | 2.00 | -1.61 | Weak Concordant | |||
| MEF2B_HUMAN | -2.34 | 2.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid