rs17462267 chr13:24212887 A>C
- Sequence
tgccgttgggagaaaccacagtaa[A/C]caacagtcaaacaaaaccagctca
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 1.98 | -0.90 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, barnes akathisia rating scale, height in controls, ldl cholesterol, resistance to kuru in aged women despite likely exposure, tetrology of fallot