rs17464589 chr13:24265299 A>G
- Sequence
cggctcatcagtttgtgctaggac[A/G]tgccatgccctgtgttacgttcaa
- ASB in cell types
- BJ (fibroblasts)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 1.33 | -0.89 | 1.00 | -2.46 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
