rs17465590 chr10:93080319 A>G
- Sequence
ccactcccgtgccagcacagatca[A/G]ttctcttgcaggtccccagaggtg
- ASB in cell types
- pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | -1.47 | 2.05 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, college completion, ldl cholesterol, mitral annular calcium, prop taste detection threshold, total cholesterol, triglycerides
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid