rs174658 chr5:169637710 G>A
- Sequence
ccagctcgccgcgtgggagacttg[G/A]ccttgtagagggagctccactctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) SEM (childhood B acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.60 | 0.76 | 1.09 | |||
| SEM (childhood B acute lymphoblastic leukemia) | 1.20 | 0.09 | 1.08 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis