rs17470892 chr4:48141184 T>C
- Sequence
aaatacagtgtatttaacaggcta[T/C]actaccacctagtggagagaatta
- ASB in cell types
- VCaP (prostate carcinoma) MS-1 (Small cell lung carcinoma) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.68 | 0.34 | 2.67 | |||
| MS-1 (Small cell lung carcinoma) | 0.51 | 0.03 | 1.00 | |||
| Kelly (neuroblastoma) | 1.19 | -0.17 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, arthritis including non-rheumatoid, body mass index (bmi), ldl cholesterol, longstanding arthritis, paternal transmission distortion, primary rhegmatogenous retinal detachment, rheumatoid arthritis, salmonella-induced pyroptosis, serum creatinine, total cholesterol, transmission distortion, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood