rs17476364 chr10:69334748 T>C
- Sequence
cctgtacccctggcactcacggtc[T/C]agctggcggtgtggaccatgcatg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARID2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARID2_HUMAN | 2.79 | -2.86 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI hematocrit, hemoglobin concentration, high light scatter reticulocyte count, high light scatter reticulocyte percentage of red cells, mean corpuscular hemoglobin, mean corpuscular volume, red blood cell count, red cell distribution width, reticulocyte count, reticulocyte fraction of red cells