rs17477850 chr1:167600382 C>G
- Sequence
caggttttccaagtgtgacatgtc[C/G]taatgtaccctatgaacaatgcca
- ASB in cell types
- tibial nerve 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | -0.48 | 1.90 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 1.85 | -0.78 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Lung, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood