rs17486278 chr15:78575140 A>C

Sequence
gcaaggttacatttctttgaaaat[A/C]aatgtggtttcaccaaatgatttg
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)
ASB for transcription factors
IKZF1_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (C) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
IKZF1_HUMAN -0.15 2.46 1.007.9·10-3 1.00 n/a n/a
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI airflow obstruction chronic obstructive pulmonary disease diffusing capacity of carbon monoxide local histogram emphysema pattern post bronchodilator fev1 post bronchodilator fev1 in copd post bronchodilator fev1/fvc ratio post bronchodilator fev1/fvc ratio in copd pulmonary artery enlargement and chronic obstructive pulmonary disease
GRASP airflow obstruction-all airflow obstruction-ever smokers airflow obstruction-never smokers lung cancer lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) nicotine dependence (smoking), cigarettes per day waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Artery_Aorta Artery_Tibial Brain_Anterior_cingulate_cortex_BA24 Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Brain_Substantia_nigra Breast_Mammary_Tissue Cells_Cultured_fibroblasts Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Muscle_Skeletal Nerve_Tibial Pituitary Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Testis Thyroid Whole_Blood

Download