rs17488437 chr3:163890948 C>T
- Sequence
cctgaagagagatcttttgtgtct[C/T]gcacagcaggacaaggccaatctt
- ASB in cell types
- embryonic stem cells-derived foregut iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cells-derived foregut | 2.38 | -2.07 | 1.00 | |||
| iPS-derived chondrocytes | 0.78 | 0.95 | 1.00 |
Items per page:
1 – 2 of 2