rs17489219 chr2:37833331 G>C
- Sequence
agttccctgaaatatatgttttta[G/C]acattttaatgactcctgttaaat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.81 | -0.16 | 1.38 | n/a | No Hit |
Items per page:
1 – 1 of 1