rs17495870 chr4:37735902 G>C
- Sequence
gaagcagattcatgattctagcag[G/C]cccagaatgcatgaagtaaagtgc
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.43 | -0.35 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, ldl cholesterol, parkinsons disease, total cholesterol, triglycerides change with statins, waist hip ratio