rs17501976 chr3:190322608 C>T
- Sequence
ggcgtggggaccacccggcaggac[C/T]aggcaccagagctgcgtccctgct
- ASB in cell types
- glioblastoma patient-derived cell model BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 2.27 | n/a | 2.00 | |||
| BEAS-2B (bronchial epithelium) | 0.79 | 0.37 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Vagina