rs175714 chr14:75515513 T>C
- Sequence
accctgaggccacaaactgccccc[T/C]actggagaaatcgctgcaggattt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) spleen
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.31 | -0.34 | 2.91 | -4.12 | Concordant | |||
| STAG1_HUMAN | 2.73 | 1.70 | 4.42 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
